Comparing dna and rna, Compare DNA and RNA with regard to | Quick Homework Help

Question: Compare DNA and RNA with regard to their structure, function, location, and activity. Ho do these molecules differ with regard to the polymerases used to synthesize them?

Question: AN E. coli transcript with the first two nucleotides 5′-AG-3′ is initiated from the segment of double-stranded DNA in Figure 5.A below:
a. Where is the transcription start site?
b. What are the approximate locations of the regions that bind the RNA polymerase homoenzyme?
c. Does transcription elongation proceed toward the right or left?
d. Which DNA strand is the template strand?
e. Which DNA strand is the RNA-coding strand?
Figure 5.A
5′-TAGTGTATTGACATGATAGAAGCACTCTTACTATAATCTCAATAGCTAACG-3′
3′-ATCACATAACTGTACTATCTTCGTGAGAATGATATTAGAGTTATCGATGC -5′

Don't use plagiarized sources. Get Your Custom Essay on
Comparing dna and rna, Compare DNA and RNA with regard to | Quick Homework Help
Get an essay WRITTEN FOR YOU, Plagiarism free, and by an EXPERT!
Order Essay

 

superadmin

Recent Posts

What is the easy difination of science | Quick Solution

Science is the pursuit and application of knowledge and understanding of the natural and social…

4 years ago

definition, values, meaning of such values and type of goods with such elasticity value …….. | Quick Solution

Clearly stating the definition, the values, the meaning of such values and the type of…

4 years ago

Acct 422 – Nora D | Quick Solution

All answered must be typed using Times New Roman (size 12, double-spaced) font. No pictures…

4 years ago

Acct 322 – Nora D | Quick Solution

All answered must be typed using Times New Roman (size 12, double-spaced) font. No pictures…

4 years ago

Macro Economics Question | Quick Solution

https://www.npr.org/sections/ed/2018/04/25/605092520/high-paying-trade-jobs-sit-empty-while-high-school-grads-line-up-for-university Click on the link above. Read the entire link and answer the questions below…

4 years ago

MGT 322 – Nora D | Quick Solution

All answered must be typed using Times New Roman (size 12, double-spaced) font. No pictures…

4 years ago