Questions: Provide specific answers in your own words. Be as detailed and specific as possible.
1. Provide several reasons why you might choose to express a protein in a prokaryotic system.
2. Provide several reasons why you might choose to express a protein in a eukaryotic system.
3. The PCR that your labmate designed is resulting in virtually no amplification. Her amplification conditions look OK, so you suspect there might be a problem with the design of her primers. What seems to be the source of the issue with her PCR? If possible, also include a diagram illustrating your answer. (Hand-drawn is OK if you are unable to generate a computerized
imageForward Primer: Reverse Primer:
5′- TGGACCTGGCAATACTCAGG -3′ 5′- ACTCCTAGCAACGGTGAACT -3′
4. Your labmate had his headphones in and was jamming out to 1989, Taylor Swift’s latest album, so he wasn’t really paying attention when he set up his electrophoresis gel. You walked into the room just as he turned on the power button. What’s wrong with the setup he used? What will happen if the gel is allowed to run? Why? (Hint: You only have about 2 minutes to correct his mistake before it’s too late and he’ll have to start all over again!)
Adapted from: Campbell, M., & Farrell, S. (2012). Biochemistry (7th ed.). Belmont, CA: Brooks/Cole, Cengage Learning.
5. You have received a sample of a new pathogen with a 10 kb genome. In order to obtain preliminary information on its genome organization, you perform restriction enzyme digestion using HindIII and Sau3AI individually as well as in combination. Provide an explanation describing and/or diagram showing the location of the HindIII and Sau3AI cut sites within the genome. (Note that one band in the double digest is twice as bright as all the other bands
6. The use of synthetic biology to develop molecular logic gates has allowed the design of complex synthetic genetic pathways with myriad combinations and applications possible. Now organisms can be engineered to perform genetic “calculations” and respond in specific ways under specific predetermined conditions.
a) The results from logic gates can be represented in what is known as a “truth table”. The two input conditions are listed (0 = off; 1 = on), along with the output condition. For a molecular AND gate, fill in the output condition in the truth table below.
A |
B |
Output |
0 |
0 |
? |
0 |
1 |
? |
1 |
0 |
? |
1 |
1 |
? |
b) Just like a molecular AND gate produces its output when both input A and B are present, a molecular OR gate produces its output when either input A or B are present:
A |
B |
Output |
0 |
0 |
0 |
0 |
1 |
1 |
1 |
0 |
1 |
1 |
1 |
1 |
With that knowledge, examine the composite logic gate below, which is made up of an AND gate and an OR gate, the outputs of which each feed into another AND gate.
If the inputs for the initial gates are controlled by the inducing chemicals A, B, C, and D (absence of the chemical = 0; presence of the chemical = 1), construct a truth table for the composite logic gate. (Hint: there are 16 possible input combinations.)
Why Work with Us
Top Quality and Well-Researched Papers
We always make sure that writers follow all your instructions precisely. You can choose your academic level: high school, college/university or professional, and we will assign a writer who has a respective degree.
Professional and Experienced Academic Writers
We have a team of professional writers with experience in academic and business writing. Many are native speakers and able to perform any task for which you need help.
Free Unlimited Revisions
If you think we missed something, send your order for a free revision. You have 10 days to submit the order for review after you have received the final document. You can do this yourself after logging into your personal account or by contacting our support.
Prompt Delivery and 100% Money-Back-Guarantee
All papers are always delivered on time. In case we need more time to master your paper, we may contact you regarding the deadline extension. In case you cannot provide us with more time, a 100% refund is guaranteed.
Original & Confidential
We use several writing tools checks to ensure that all documents you receive are free from plagiarism. Our editors carefully review all quotations in the text. We also promise maximum confidentiality in all of our services.
24/7 Customer Support
Our support agents are available 24 hours a day 7 days a week and committed to providing you with the best customer experience. Get in touch whenever you need any assistance.
Try it now!
How it works?
Follow these simple steps to get your paper done
Place your order
Fill in the order form and provide all details of your assignment.
Proceed with the payment
Choose the payment system that suits you most.
Receive the final file
Once your paper is ready, we will email it to you.
Our Services
No need to work on your paper at night. Sleep tight, we will cover your back. We offer all kinds of writing services.
Essays
No matter what kind of academic paper you need and how urgent you need it, you are welcome to choose your academic level and the type of your paper at an affordable price. We take care of all your paper needs and give a 24/7 customer care support system.
Admissions
Admission Essays & Business Writing Help
An admission essay is an essay or other written statement by a candidate, often a potential student enrolling in a college, university, or graduate school. You can be rest assurred that through our service we will write the best admission essay for you.
Reviews
Editing Support
Our academic writers and editors make the necessary changes to your paper so that it is polished. We also format your document by correctly quoting the sources and creating reference lists in the formats APA, Harvard, MLA, Chicago / Turabian.
Reviews
Revision Support
If you think your paper could be improved, you can request a review. In this case, your paper will be checked by the writer or assigned to an editor. You can use this option as many times as you see fit. This is free because we want you to be completely satisfied with the service offered.