A. MICROBIOME
1) In the accompanying microbiome dataset 12, which includes the known 16SrRNA sequences of 5 different gut microbiota, identify which species the last sequence (seq5) corresponds to.
2) Identify a substring in each sequence of no more than 30 bases that uniquely distinguishes each species but comes from the same region of the sequence. Report the coordinates (relative to seq1) where your substring came from, and write out the 5 unique sequences as they would appear in a multiple alignment.
3) Why do you think the region where your substring came from is more variable than most of the rest of the sequence?
4) Dataset 1 and dataset 2 were derived from 16s sequencing of a malnourished and well fed individual respectively, with all other variables (e.g. age, sex) perfectly matched. Using the substrings above, count the number of 16s rRNA derived from the 5 species you identified above. The “find” function in excel may be useful here. You can assume that there exist no other species with the same substring as those that you are measuring. Report your counts in table format with column headings: dataset 2, dataset 3, and row labels: your 5 species. (3 marks) N.B. “.tab” (tab-delimited) files can be opened with Excel. For Mac users, you may need to change it to “.txt” before opening.
6) Which of the 5 species differs the most in its abundance between the two individuals?
B. CONSERVATION AND POSITIVE SELECTION OF NON-CODING RNA
Many non-coding RNAs are turning out to have very important conserved functions. The HAR1A (Human accelerated region 1) sequenceis expressed in human cerebral cortex during early human development. Part of the sequence appears to be under strong positive selection and is referred to as Human accelerated region 1
1. Use BLAT to call up the sequence forHuman Accelerated Region A (HAR1A) using the following segment of human HAR1A: AGACGTTACAGCAACGTGTCAGCTGAAATGATGGGCGTAGACGCACGT
Show the screen shot.
2. Is the conservation limited to this short search sequence? Show data.
3. Do a CLUSTALW alignment of the region in 1) plus 100 nucleotides from either side for vertebrates ranging from Human to fish. Use at least 10 species and include available primates as well as the species in Question 5. Show the alignment.
4. Show the graphical phylogenetic relationship using the alignment.
5. How many changes are present between the Human and Chimp? Chimp to Mouse? Chimp to Opossum?
C. GENEMANIA AND BIOGRID
Links to these sites and descriptive material in Nucleic Acids Research are shown below.
GENEMANIAhttp://genemania.org/
NAR: https://academic.oup.com/nar/article/38/suppl_2/W214/1126704/The-GeneMANIA-prediction-server-biological-network
BIOGRID https://thebiogrid.org/
NAR: https://academic.oup.com/nar/article/45/D1/D369/2681732/The-BioGRID-interaction-database-2017-update
1. Go to Genemania.
Choose a protein of interest that is present in any of the species (dropdown icon, upper left panel). On the right side of the upper left panel is a drop down menu to toggle on/off various types of interaction. Turn off everything except Physical interactions. Show the output.
2. The image will show reported physical interactions as well as predicted interactions. The displayed information will show on the right hand side of the page. Turn off everything except the one you searched for. Try toggling on/off the various types of data on the left hand menu. Show at least three variations on the theme. Be sure to include Attributes alone.
3. Go to BioGrid and input the same protein/organism. The initial image displays all information. On the Switch View panel click the Interactors, Interactions, and then Network. Show image of the last one. How does the view compare to Genemania?
Attachment:- Assignment Files.rar
Why Work with Us
Top Quality and Well-Researched Papers
We always make sure that writers follow all your instructions precisely. You can choose your academic level: high school, college/university or professional, and we will assign a writer who has a respective degree.
Professional and Experienced Academic Writers
We have a team of professional writers with experience in academic and business writing. Many are native speakers and able to perform any task for which you need help.
Free Unlimited Revisions
If you think we missed something, send your order for a free revision. You have 10 days to submit the order for review after you have received the final document. You can do this yourself after logging into your personal account or by contacting our support.
Prompt Delivery and 100% Money-Back-Guarantee
All papers are always delivered on time. In case we need more time to master your paper, we may contact you regarding the deadline extension. In case you cannot provide us with more time, a 100% refund is guaranteed.
Original & Confidential
We use several writing tools checks to ensure that all documents you receive are free from plagiarism. Our editors carefully review all quotations in the text. We also promise maximum confidentiality in all of our services.
24/7 Customer Support
Our support agents are available 24 hours a day 7 days a week and committed to providing you with the best customer experience. Get in touch whenever you need any assistance.
Try it now!
How it works?
Follow these simple steps to get your paper done
Place your order
Fill in the order form and provide all details of your assignment.
Proceed with the payment
Choose the payment system that suits you most.
Receive the final file
Once your paper is ready, we will email it to you.
Our Services
No need to work on your paper at night. Sleep tight, we will cover your back. We offer all kinds of writing services.
Essays
No matter what kind of academic paper you need and how urgent you need it, you are welcome to choose your academic level and the type of your paper at an affordable price. We take care of all your paper needs and give a 24/7 customer care support system.
Admissions
Admission Essays & Business Writing Help
An admission essay is an essay or other written statement by a candidate, often a potential student enrolling in a college, university, or graduate school. You can be rest assurred that through our service we will write the best admission essay for you.
Reviews
Editing Support
Our academic writers and editors make the necessary changes to your paper so that it is polished. We also format your document by correctly quoting the sources and creating reference lists in the formats APA, Harvard, MLA, Chicago / Turabian.
Reviews
Revision Support
If you think your paper could be improved, you can request a review. In this case, your paper will be checked by the writer or assigned to an editor. You can use this option as many times as you see fit. This is free because we want you to be completely satisfied with the service offered.