Write the sequence of the primary rna transcript | Quick Homework Help

Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5′ AUGU3′. Carefully examine the sequence and then answer the questions.
Strand A: 5’GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAAGTTAATCACACAGGAAACAGCTATGACCATGATT 3′
Strand B: 3’CGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTCAATTAGTGTGTCCTTTGTCGATACTGGTACTAA 5′
A. Where is the trascription start site?
B. find TTTACA around -35 region and box it. (my answer is highlighted in yellow above)
C. find TATGTT around -10 region and box it. (my answer highlighted pink above)
D. lable template and coding strands (my answer: template is strand B and coding is strand A)
E. does transcription elongation proceed towards the right or left? (my answer: right)
F. write the sequence of the primary RNA transcript starting at 5′ aUUGU3′. include polarity of the transcript.

Don't use plagiarized sources. Get Your Custom Essay on
Write the sequence of the primary rna transcript | Quick Homework Help
Get an essay WRITTEN FOR YOU, Plagiarism free, and by an EXPERT!
Order Essay
superadmin

Recent Posts

What is the easy difination of science | Quick Solution

Science is the pursuit and application of knowledge and understanding of the natural and social…

3 years ago

definition, values, meaning of such values and type of goods with such elasticity value …….. | Quick Solution

Clearly stating the definition, the values, the meaning of such values and the type of…

3 years ago

Acct 422 – Nora D | Quick Solution

All answered must be typed using Times New Roman (size 12, double-spaced) font. No pictures…

3 years ago

Acct 322 – Nora D | Quick Solution

All answered must be typed using Times New Roman (size 12, double-spaced) font. No pictures…

3 years ago

Macro Economics Question | Quick Solution

https://www.npr.org/sections/ed/2018/04/25/605092520/high-paying-trade-jobs-sit-empty-while-high-school-grads-line-up-for-university Click on the link above. Read the entire link and answer the questions below…

3 years ago

MGT 322 – Nora D | Quick Solution

All answered must be typed using Times New Roman (size 12, double-spaced) font. No pictures…

3 years ago