Solution-Which pair has the highest degree of nucleotide | Quick Homework Help

1. Short regions of DNA sequence from four different organisms are shown below.

Organism A         AGGTAAGTTACATTTGCAAGCTCTATTGACGCCC
Organism B         AGGTAAGTTAGATTTGCAGGTCCTATTGACGCCC
Organism C         AGGTAAGTTAGATTCGCAGGTCCTATTGACGCCC
Organism D         AGCTAAGTTAGATTTGCAGGTCCTATTGACGCCC

Don't use plagiarized sources. Get Your Custom Essay on
Solution-Which pair has the highest degree of nucleotide | Quick Homework Help
Get an essay WRITTEN FOR YOU, Plagiarism free, and by an EXPERT!
Order Essay

Here are the same sequences aligned below for you to highlight their differences in sequence:

A) Strictly on the basis of these sequences (i.e. – extent of homology) briefly describe the phylogenetic relationship of these three organisms (i.e – which are the more closely or distantly related)

B) Draw a rooted tree that illustrates your conclusions. (Use Fig. 17.17 in your text and the Phylogenetic Trees animation in the chapter 17 section of iLearn as guides for how to proceed with this part.)

C) Assume that the sequences above were obtained from 16s rRNA genes and that the percent sequence similarity you determined for these short sequences is the same as that for the entire 16s rRNA coding regions. AIDitionally, assume that: 1) further analysis reveals that several orthologous genes have the same percent similarity that you saw in the SSU analysis and 2) total genomic DNA hybridization analysis reveals the percent similarity shown in the table below. Using the working definition of a species described in section 17.5 of the class textbook (3rd edition) and the guidelines in Figure 1 below, complete the table below. NOTE: the guidelines in the textbook are more up-to-date and take more factors into consideration than the guidelines in Figure 12, which are based solely on DNA hybridization data. Therefore, the guidelines in section 17.5 should take preference in cases where the two methods lead to alternative results.

 

 

% similarity(DNA hybridization)

Same genus?

Same species?

Organisms A and D

20

Organisms C and D

79

Organisms B and D

71

D) Based on the data in part C above:

i) Which pair of organisms would you expect to have the highest degree of nucleotide similarity in theirinformational genes (as discussed in section 17.3)?

ii) Which pair has the highest degree of nucleotide similarity in their operational genes?

2. The purple phototrophic bacteria and the cyanobacteria can both generate energy by photosynthesis but differ physiologically and ecologically in the way they do it. Which of these two photosynthetic organisms has remained more metabolically and ecologically similar to their last common ancestor? Explain the reasoning behind your answer.

3. Eukaryotic cells are generally more highly compartmentalized than prokaryotic cells. In aIDition to thenucleus, eukaryotes contain a number of subcellular membrane-enclosed organelles in the cytoplasmincluding, the endoplasmic reticulum, the Golgi, endosomes, hydrogenosomes, lysosomes,mitochondria, peroxisomes and, in photosynthetic organisms, chloroplasts. AIDitionally, eukaryotic cells also contain transport vesicles that move cargo among particular organelles and secretory vesicles that deliver cargo to the cytoplasmic membrane.

For each of the proteins below, list all of the subcellular organelles (indicated in bold type above) involved in its expression and targeting. For example, for the expression of a cytoplasmic protein, the mRNA for the gene encoding it is transcribed in the nucleus and transported to the cytoplasm where the protein is translated and released, so an appropriate answer would be: nucleus and cytoplasm. The material in your textbook’s appendix A2.4 should be helpful in answering these following questions.

A. a protein that is secreted from the cell

2. a lysosomal protein
3. a nuclear protein
4. the envelope glycoprotein (env) of HIV-1

In which compartments do the following processes occur?
5. oxidative phosphorylation
6. hydrolysis of macromolecules (such as proteins, fats and carbohydrates) that are taken up from the extracellular space by endocytosis or phagocytosis
7. photosynthesis
8. oxidation of pyruvate
9. transcription
10. glycosylation of proteins
11. sorting of proteins to appropriate organelles such as lysosomes.

Quick Homework Essays
Calculate your paper price
Pages (550 words)
Approximate price: -

Why Work with Us

Top Quality and Well-Researched Papers

We always make sure that writers follow all your instructions precisely. You can choose your academic level: high school, college/university or professional, and we will assign a writer who has a respective degree.

Professional and Experienced Academic Writers

We have a team of professional writers with experience in academic and business writing. Many are native speakers and able to perform any task for which you need help.

Free Unlimited Revisions

If you think we missed something, send your order for a free revision. You have 10 days to submit the order for review after you have received the final document. You can do this yourself after logging into your personal account or by contacting our support.

Prompt Delivery and 100% Money-Back-Guarantee

All papers are always delivered on time. In case we need more time to master your paper, we may contact you regarding the deadline extension. In case you cannot provide us with more time, a 100% refund is guaranteed.

Original & Confidential

We use several writing tools checks to ensure that all documents you receive are free from plagiarism. Our editors carefully review all quotations in the text. We also promise maximum confidentiality in all of our services.

24/7 Customer Support

Our support agents are available 24 hours a day 7 days a week and committed to providing you with the best customer experience. Get in touch whenever you need any assistance.

Try it now!

Calculate the price of your order

Total price:
$0.00

How it works?

Follow these simple steps to get your paper done

Place your order

Fill in the order form and provide all details of your assignment.

Proceed with the payment

Choose the payment system that suits you most.

Receive the final file

Once your paper is ready, we will email it to you.

Our Services

No need to work on your paper at night. Sleep tight, we will cover your back. We offer all kinds of writing services.

Essays

Essay Writing Service

No matter what kind of academic paper you need and how urgent you need it, you are welcome to choose your academic level and the type of your paper at an affordable price. We take care of all your paper needs and give a 24/7 customer care support system.

Admissions

Admission Essays & Business Writing Help

An admission essay is an essay or other written statement by a candidate, often a potential student enrolling in a college, university, or graduate school. You can be rest assurred that through our service we will write the best admission essay for you.

Reviews

Editing Support

Our academic writers and editors make the necessary changes to your paper so that it is polished. We also format your document by correctly quoting the sources and creating reference lists in the formats APA, Harvard, MLA, Chicago / Turabian.

Reviews

Revision Support

If you think your paper could be improved, you can request a review. In this case, your paper will be checked by the writer or assigned to an editor. You can use this option as many times as you see fit. This is free because we want you to be completely satisfied with the service offered.