Express a protein in a prokaryotic system | Quick Homework Help

Questions: Provide specific answers in your own words. Be as detailed and specific as possible.

1. Provide several reasons why you might choose to express a protein in a prokaryotic system.

Don't use plagiarized sources. Get Your Custom Essay on
Express a protein in a prokaryotic system | Quick Homework Help
Get an essay WRITTEN FOR YOU, Plagiarism free, and by an EXPERT!
Order Essay

2. Provide several reasons why you might choose to express a protein in a eukaryotic system.

3. The PCR that your labmate designed is resulting in virtually no amplification. Her amplification conditions look OK, so you suspect there might be a problem with the design of her primers. What seems to be the source of the issue with her PCR? If possible, also include a diagram illustrating your answer. (Hand-drawn is OK if you are unable to generate a computerized

imageForward Primer:                             Reverse Primer:
5′- TGGACCTGGCAATACTCAGG -3′   5′- ACTCCTAGCAACGGTGAACT -3′

4. Your labmate had his headphones in and was jamming out to 1989, Taylor Swift’s latest album, so he wasn’t really paying attention when he set up his electrophoresis gel. You walked into the room just as he turned on the power button. What’s wrong with the setup he used? What will happen if the gel is allowed to run? Why? (Hint: You only have about 2 minutes to correct his mistake before it’s too late and he’ll have to start all over again!)

Adapted from: Campbell, M., & Farrell, S. (2012). Biochemistry (7th ed.). Belmont, CA: Brooks/Cole, Cengage Learning.

5. You have received a sample of a new pathogen with a 10 kb genome. In order to obtain preliminary information on its genome organization, you perform restriction enzyme digestion using HindIII and Sau3AI individually as well as in combination. Provide an explanation describing and/or diagram showing the location of the HindIII and Sau3AI cut sites within the genome. (Note that one band in the double digest is twice as bright as all the other bands

6. The use of synthetic biology to develop molecular logic gates has allowed the design of complex synthetic genetic pathways with myriad combinations and applications possible. Now organisms can be engineered to perform genetic “calculations” and respond in specific ways under specific predetermined conditions.

a) The results from logic gates can be represented in what is known as a “truth table”. The two input conditions are listed (0 = off; 1 = on), along with the output condition. For a molecular AND gate, fill in the output condition in the truth table below.

 

A

B

Output

0

0

?

0

1

?

1

0

?

1

1

?

b) Just like a molecular AND gate produces its output when both input A and B are present, a molecular OR gate produces its output when either input A or B are present:

A

B

Output

0

0

0

0

1

1

1

0

1

1

1

1

With that knowledge, examine the composite logic gate below, which is made up of an AND gate and an OR gate, the outputs of which each feed into another AND gate.

If the inputs for the initial gates are controlled by the inducing chemicals A, B, C, and D (absence of the chemical = 0; presence of the chemical = 1), construct a truth table for the composite logic gate. (Hint: there are 16 possible input combinations.)

superadmin

Recent Posts

What is the easy difination of science | Quick Solution

Science is the pursuit and application of knowledge and understanding of the natural and social…

3 years ago

definition, values, meaning of such values and type of goods with such elasticity value …….. | Quick Solution

Clearly stating the definition, the values, the meaning of such values and the type of…

3 years ago

Acct 422 – Nora D | Quick Solution

All answered must be typed using Times New Roman (size 12, double-spaced) font. No pictures…

3 years ago

Acct 322 – Nora D | Quick Solution

All answered must be typed using Times New Roman (size 12, double-spaced) font. No pictures…

3 years ago

Macro Economics Question | Quick Solution

https://www.npr.org/sections/ed/2018/04/25/605092520/high-paying-trade-jobs-sit-empty-while-high-school-grads-line-up-for-university Click on the link above. Read the entire link and answer the questions below…

3 years ago

MGT 322 – Nora D | Quick Solution

All answered must be typed using Times New Roman (size 12, double-spaced) font. No pictures…

3 years ago